View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19971_low_30 (Length: 353)
Name: NF19971_low_30
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19971_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 141 - 337
Target Start/End: Original strand, 12553388 - 12553584
Alignment:
| Q |
141 |
gcagcttgacatccacttctgcgtcacaaatttcgtggtagaggaataattgattatctttgagaataatcacatcaacacatgctcaacgaagttcgta |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12553388 |
gcagcttgacatccacttctgcgtcacaaatttcgtggtagaggaataattgattatctttgagaataatcacatcaacacatactcaacgaagttcgta |
12553487 |
T |
 |
| Q |
241 |
tagtttgattcattaattcatattatggcttttataatattattgtttagattcatttgtaattttatacatgggatgtaataattattgtagtttt |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12553488 |
tagtttgattcattaattcatattatggcttttataatattattgtttagattcatttgtaattttatacatgggatgtaataattattgtagtttt |
12553584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 29 - 109
Target Start/End: Original strand, 12553277 - 12553357
Alignment:
| Q |
29 |
tatatatatagacacacacatacatgcatgtgtgtgtagcttttgaaaagagaaaaacttacaatgtcttccattaaatct |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12553277 |
tatatatatagacacgcacatacatgcatgtgtgtgtagcttttgaaaagagaaaaacttacaatgtcttccattaaatct |
12553357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University