View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19971_low_33 (Length: 330)
Name: NF19971_low_33
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19971_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 301; Significance: 1e-169; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 31910117 - 31910433
Alignment:
| Q |
1 |
gttgggatttgattcaggtccttgtggatgcataatgcactcatgatggttcagttaaacatattcagaagttcaacattggggctggactactcttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31910117 |
gttgggatttgattcaggtccttgtggatgcagaatgcactcatgatggttcagttaaacatattcagaagttcaacattggggatggactactcttcaa |
31910216 |
T |
|
| Q |
101 |
taaattttggtgtaatgtaacccacatttattatctttttcttttgtatctcaccacagctgaatctttttcttttattgtaacttatctatgatgtttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910217 |
taaattttggtgtaatgtaacccacatttattatctttttcttttgtatctcaccacagctgaatctttttcttttattgtaacttatctatgatgtttg |
31910316 |
T |
|
| Q |
201 |
ctagcatagaattatgggacctgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatctcaatctctattacactctttcacaaatttt |
300 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910317 |
ctagcatagaattgtgggagctgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatctcaatctctattacactctttcacaaatttt |
31910416 |
T |
|
| Q |
301 |
acattctagcaccatat |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31910417 |
acattctagcaccatat |
31910433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 31901581 - 31901670
Alignment:
| Q |
1 |
gttgggatttgattcaggtccttgtggatgcataatgcactcatgatggttcagttaaacatattcagaag-ttcaacattggggctgga |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||| || |||| |||||||||| |
|
|
| T |
31901581 |
gttgggatttgattcaggtccttgtggatgcagaatgcactcatgatggctcaattaaacatattcagaagtttgaacaatggggctgga |
31901670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 187 - 269
Target Start/End: Original strand, 31902967 - 31903049
Alignment:
| Q |
187 |
atctatgatgtttgctagcatagaattatgggacctgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatc |
269 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | |||||||||||| |||||| ||||||||| |||| ||||||||||| |
|
|
| T |
31902967 |
atctatgatgtttgctagcatagaatcctgggaacgactaaaatggaccatggtccacaacagatcgcattattcattcaatc |
31903049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 271
Target Start/End: Original strand, 13643241 - 13643290
Alignment:
| Q |
222 |
tgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatctc |
271 |
Q |
| |
|
|||||||||| ||| | |||| ||||| |||||||||||||||||||||| |
|
|
| T |
13643241 |
tgctaaaatgaaccattgtccacaacatatcacatttttcattcaatctc |
13643290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University