View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19971_low_47 (Length: 275)
Name: NF19971_low_47
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19971_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 108 - 266
Target Start/End: Complemental strand, 7651499 - 7651329
Alignment:
| Q |
108 |
atcatacataaagtttcttattatgtatatcaaccctacgaatagaagttttatgtttagaaaaaggaagnnnnnnncattgatgcatgttcttcagctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
7651499 |
atcatacataaagtttcttattatgtatatcaaccctacgaatagaagttttatgtttagaaaaaagaagaaaaaaacattgatgcatgttcttcagctt |
7651400 |
T |
|
| Q |
208 |
gtggcattatagatgtttccat------------caatcaactatttgctgacacctattttgtcttcatc |
266 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7651399 |
gtggcattatagatgtttccatcaatcacacaagcaatcaactatttgctgacacctattttgtcttcatc |
7651329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 7652005 - 7651907
Alignment:
| Q |
1 |
taagacatttttaatgattgaggtaagatgttctcatttgatttttaagtttagccgatatgcaataacgtctaaaatagttttacaacatcattaaat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7652005 |
taagacatttttaatgattgaggtaagatgttctcatttgatttttaagtttagccgatatgcaataacgtctaaaatagttttacaacatcattaaat |
7651907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University