View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19971_low_51 (Length: 253)

Name: NF19971_low_51
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19971_low_51
NF19971_low_51
[»] scaffold0536 (1 HSPs)
scaffold0536 (124-196)||(9480-9552)


Alignment Details
Target: scaffold0536 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0536
Description:

Target: scaffold0536; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 196
Target Start/End: Complemental strand, 9552 - 9480
Alignment:
124 ttctgctttatattgcttttaatgtccaacatgccctcatctacgactggtgcacatttaattgaatgagaaa 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9552 ttctgctttatattgcttttaatgtccaacatgccctcatctacgactggtgcacatttaattgaatgagaaa 9480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University