View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19971_low_60 (Length: 213)
Name: NF19971_low_60
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19971_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 38 - 202
Target Start/End: Complemental strand, 7543333 - 7543169
Alignment:
| Q |
38 |
gactagtggtggcaaagagcatttactataaattattagatcaatatacatcaatgaatagacaaaaactggaggttatgaaaactatataagtgtgtnn |
137 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7543333 |
gactattggtggcaaagagcatttactataaattattagatcaatatacatcaatgaatagacaaaaactggaggttatgaaaactatataagtgagtaa |
7543234 |
T |
 |
| Q |
138 |
nnnnnnnnnnnnntatacaaatgtctatttctctacaaatctgatcaacaaaattaacaattcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7543233 |
aaaaactaaaaaatatacaaatgtctatttctctacaaatctgatcaacaaaattaacaattcat |
7543169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University