View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19972_high_13 (Length: 288)
Name: NF19972_high_13
Description: NF19972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19972_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 53057255 - 53057510
Alignment:
| Q |
15 |
atgaatcaaaccaaccaccaaccagtgaattggccagttttcggttcaattggtagaactggccgattcggtctgttttaaaacattgacatgaaaattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53057255 |
atgaatcaaaccaaccaccaaccagtgaattggccagttttcggttcaattggtagaactggccgattcggtctgttttaaaacattgacatgaaaattg |
53057354 |
T |
|
| Q |
115 |
aagtaggatgtaacatgaacaatagatttagacaacaatgaaaccaactaacatgtcagtctatgattatatgatgacagcagcagtggcaggcagtacc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53057355 |
aagtaggatgtaacatgaacaatagatttaggcaacaatgaaaccaactaacatgtcagtttatgattatatgatgacagcagcagtggcaggcagtacc |
53057454 |
T |
|
| Q |
215 |
gaccataaagcccttaacagtagtacttaattcatctgcaactctggcctcagaaa |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53057455 |
taccataaagcccttaacagtagtacttaattcatctgcaactctggcctcagaaa |
53057510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University