View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19972_low_15 (Length: 240)
Name: NF19972_low_15
Description: NF19972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19972_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 25628377 - 25628598
Alignment:
| Q |
19 |
agacttgtcataatccaacccctatttgctactttaattaaactcaaaccccaaaattacctcctgttgcccaatatatgattttttggctatgcatcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25628377 |
agacttgtcataatccaacccctatttgctactttaattaaactcaaaccccaaaattacctcctgttgcccaatatatgattttttggctatgcatcta |
25628476 |
T |
 |
| Q |
119 |
caccaataggcatcacccgaaatccaaatgctgaatactagcagacttggtaatattgtaaactaaaccagcatcaatccaagttaagcggaaaagaaaa |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25628477 |
caccaataggcatcacccaaaatccaaatgctgaatactagcagacttggtaatattgtaaactaaaccagcatcaatccaagttgagcggaaaagaaaa |
25628576 |
T |
 |
| Q |
219 |
caaaatcagtataaaaactgac |
240 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
25628577 |
caaaatcagcataaaaactgac |
25628598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University