View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19972_low_16 (Length: 240)
Name: NF19972_low_16
Description: NF19972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19972_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 51 - 229
Target Start/End: Original strand, 24506673 - 24506851
Alignment:
| Q |
51 |
aagacctacttgttcatacatttgacattgagaaatgagaacatcagcgacatcctcggtcgattcatcaatgtctaaagggaaattatttccttcgttt |
150 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24506673 |
aagacctacttgttcataaatttgacattgagaaatgagaacatcagcgacatcctcagtcgattcatcaatgtctaaagggaaattacttccttcgttt |
24506772 |
T |
 |
| Q |
151 |
tggtagagatgttcgttcggacagctgcattgctaaaacttggtcgtccccaacgaaatacttgttttgatcttcctat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24506773 |
tggtagagatgttcgttcggacagctgcattgctaaaacttggtcgtccccaacgaaatacttgttttgatctttctat |
24506851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 48
Target Start/End: Original strand, 24506624 - 24506654
Alignment:
| Q |
18 |
gaaactgctccctgaaacccaaatagtccat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24506624 |
gaaactgctccctgaaacccaaatagtccat |
24506654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University