View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19972_low_21 (Length: 229)
Name: NF19972_low_21
Description: NF19972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19972_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 9684870 - 9684674
Alignment:
| Q |
17 |
tagggagttgaatcatgagctgattgagattgtgaagtctaagtatggggaagttgtgcgtatggcacatatgcatgatttcacggctaatgagaatagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
9684870 |
tagggagttgaatcatgagctgattgaaattgtgaagtctaagtatggggaagctgtgcgtatggtacatatgcatgatttcatggctaatgagaatagg |
9684771 |
T |
|
| Q |
117 |
aaagctacgttgacagtgtggtttgatgagaggaacaaaacagatgggggtttagccttatctatgtggcaccgaccaaagatgtgtcctgtgtctga |
214 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||| |||||||| | | |||||| | || ||||||||||||| ||||| ||||||||| |
|
|
| T |
9684770 |
aaagctacgttgaaagtgtgggttgatgagaggaacaaaatagatggggtctca-ccttatatctgatgcaccgaccaaaggcgtgtcttgtgtctga |
9684674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 165
Target Start/End: Complemental strand, 9688905 - 9688768
Alignment:
| Q |
28 |
atcatgagctgattgagattgtgaagtctaagtatggggaagttgtgcgtatggcacatatgcatgatttcacggctaatgagaataggaaagctacgtt |
127 |
Q |
| |
|
|||| |||||||||||| || | ||||||||||||| || ||| |||||| ||||| || |||||||| || ||||||| |||| || | |||| |
|
|
| T |
9688905 |
atcaggagctgattgagtttattaagtctaagtatgaggttcatgttcgtatgtcacatgtgattgatttcatggtggatgagaaaaggagagttgcgtt |
9688806 |
T |
|
| Q |
128 |
gacagtgtggtttgatgagaggaacaaaacagatgggg |
165 |
Q |
| |
|
|| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9688805 |
gaaagtttggactgatgagaggaacaaaacagatgggg |
9688768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University