View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19972_low_25 (Length: 204)
Name: NF19972_low_25
Description: NF19972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19972_low_25 |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 83 - 185
Target Start/End: Complemental strand, 23268304 - 23268207
Alignment:
| Q |
83 |
ctattcacattgtcttcttcaccgaacgttcaccctgtagtttggtattctttctttaccgtcacaaccccatcttacctctttgctcgcaaatcttatt |
182 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23268304 |
ctattcacattgtcttcttcacc-----ttcaccctgccgcttggtattctttctttaccgtcacacccccatcttacctctttgctcgcaaatcttatt |
23268210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 123 - 164
Target Start/End: Complemental strand, 68623 - 68582
Alignment:
| Q |
123 |
tttggtattctttctttaccgtcacaaccccatcttacctct |
164 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
68623 |
tttggtattctttcttcacaatcacaaccccatcttacctct |
68582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University