View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_high_21 (Length: 398)
Name: NF19973_high_21
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 382
Target Start/End: Original strand, 44005933 - 44006310
Alignment:
| Q |
1 |
cctagtgtcatctgcatggctatgttcttacatatccattgtctttacttttgttggtattgatctataacgggagaataaaaagtaacatgattatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44005933 |
cctagtgtcatctgcatggctatgttcttacatatccattgtctttacttttgttgatattgatctataacgggagaataaaaagtaacatgattatgca |
44006032 |
T |
|
| Q |
101 |
aataattcagatttattttgtttaagcaactgccatgtctatagtaattattactgtgttagctcagctgctgctgttatttttcttgttgtttctctct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44006033 |
aataattcagatttattttgtttaagcaactgccatgtctatagtaattattactgtgttagctcagctgctgctgttatttttc---ttgtttctctct |
44006129 |
T |
|
| Q |
201 |
tttgtattcccttttgcgtgctcttgctcatcttgtgctcaaagcttcctgtgattaataaattttgctaattcnnnnnnnnnnnnntgtctatagtaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44006130 |
tttgtattcccttttgcgtgctcttgctcatcttgtgctcaaagcttcctgtgattaataaattttgctaattc-aaaaaaaaaatatgtctatagtaat |
44006228 |
T |
|
| Q |
301 |
cggatgtttttctttgnnnnnnnctacaaccaaatgttattatgaaagtgatcaattgtcctgtctaaagtaacatgatgat |
382 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006229 |
cggatgtttttctttgaaaaaaactacaaccaaatgttattatgaaagtgatcaattgtcctgtctaaagtaacatgatgat |
44006310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University