View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_high_35 (Length: 305)
Name: NF19973_high_35
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 54 - 198
Target Start/End: Original strand, 51010292 - 51010433
Alignment:
| Q |
54 |
aagctttagcttctgatgaatacccttatggctttgtatcttcatcaggaggatagactttgaaagtgacaatgagactcttgtgcgttgtttgctcaat |
153 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010292 |
aagctttagcatctgatgaatacccttatggctttgtatcttcc---ggaggatagactttgaaagtgacaatgagactcttgtgcgttgtttgctcaat |
51010388 |
T |
 |
| Q |
154 |
gaatttgacagggacgggacagatctagatataggaactacttag |
198 |
Q |
| |
|
||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51010389 |
gaagttgacagggacgggacatatctagatataggaactacttag |
51010433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University