View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_high_42 (Length: 274)
Name: NF19973_high_42
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_high_42 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 80 - 274
Target Start/End: Original strand, 35019379 - 35019573
Alignment:
| Q |
80 |
gtgatattagatagttgtaactaactcaatctatcatcatcccttctagtttgtactttctctgttgataaaatctatacacagagaagtacatatgaca |
179 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35019379 |
gtgatattagatccttgtaactaactcaatctatcatcatcccttctaatttgtactttctctgttgataaaatctatacacagagaagtacatatgaca |
35019478 |
T |
|
| Q |
180 |
catctaaccaccatggatacaaataatatactactctcattacaatctcttccagttacaatatgcgccaccttcttctttctcttccttctatt |
274 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35019479 |
tatcaaaccaccatggatacaaataatatactactctcattacaatctcttccggttacaatatgcgccaccttcttctttctcttccttctatt |
35019573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 271
Target Start/End: Original strand, 35029516 - 35029652
Alignment:
| Q |
128 |
gtttgtactttctctgttgataaaatctatacacagagaagtacatatgacacatctaaccaccatggatacaaataatatactactctcattacaatct |
227 |
Q |
| |
|
|||||||||||||||| | | |||| |||||||||||||||||||||| ||| ||| ||||||||||||| ||||||||||||| | ||||| |
|
|
| T |
35029516 |
gtttgtactttctctgctcacaaaacctatacacagagaagtacatatcacaa-------cactatggatacaaatattatactactctcactgcaatcc |
35029608 |
T |
|
| Q |
228 |
cttccagttacaatatgcgccaccttcttctttctcttccttct |
271 |
Q |
| |
|
|||||| ||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
35029609 |
cttccacttacaatatgctccaccttgttgtttctcttccttct |
35029652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University