View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_high_46 (Length: 254)
Name: NF19973_high_46
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_high_46 |
 |  |
|
| [»] scaffold0536 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0536 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 11120 - 11302
Alignment:
| Q |
1 |
caattataaaacataataaaaattatgaatttgttagactcaaatgtaataaagagcaatgtgttaaggagaagtatgttggttttaacaaacactttta |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11120 |
caattataaaacagaataaaaattatgaatttgttagactcaaatgtaataaagagcaatgtgttaaggaggagtatgttggttttaacaaacactttta |
11219 |
T |
 |
| Q |
101 |
gcatgacttgctagtatgcggttgtatctgttgttcaatgggtgttgttaaagagtttggatatattttgtttgagcacattg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11220 |
gcatgacttgctagtatgcggttgtatctgttgttcaatgggtgttgttaaagagtttggatatattttgtttgagcacattg |
11302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 48914825 - 48914783
Alignment:
| Q |
177 |
cacattgctattagttgaatttttccatttgagcacatacaac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48914825 |
cacattgctattagttgaatttttccatttgagcacatacaac |
48914783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University