View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_high_53 (Length: 241)
Name: NF19973_high_53
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 48960434 - 48960210
Alignment:
| Q |
1 |
gtttgcattagagacatgtgaaaacatagttagcagacgaagttcatctctcggccccaacaacttcatagccatctccacattgatatcaaatgtctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48960434 |
gtttgcattagagacatgtgaaaacatagttagcagacgaagttcatctctcggccccaacaacttcatagccatctccacattgatatcaaatgtctat |
48960335 |
T |
 |
| Q |
101 |
cttggtcttagtttttggtatcagcagatctacacatgcaaacaatagtgaacatgttgctaaaatgtactctgcactaatgcaaagagaatactataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48960334 |
cttggtcttagtttttggtatcagcacatctacacatgcaaacaatagtgaacatgttgctaaaatgtactctgcactaatgcaaagagaatactataaa |
48960235 |
T |
 |
| Q |
201 |
aggaaaaaatatgttccgttctgta |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48960234 |
aggaaaaaatatgttccgttctgta |
48960210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 55 - 120
Target Start/End: Complemental strand, 48964731 - 48964666
Alignment:
| Q |
55 |
ccccaacaacttcatagccatctccacattgatatcaaatgtctatcttggtcttagtttttggta |
120 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| ||| |||| |||||||||||||||||| |||||| |
|
|
| T |
48964731 |
ccccaacaacttggtagccatcttcacattggtatgaaatatctatcttggtcttagttattggta |
48964666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University