View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_high_68 (Length: 214)
Name: NF19973_high_68
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 98 - 198
Target Start/End: Complemental strand, 35909856 - 35909756
Alignment:
| Q |
98 |
tttagaactagctttgctaatggttgacaagtatcacaaacaagcttgttcattaacaacattctcccatatgactgacttagaaatagtaaagtgttat |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35909856 |
tttagaactagctttgctaatgtttgacaagtatcacaaacaagcttgttcattaacaacattctcccatatgactgacttagaaatagtaaagtgttat |
35909757 |
T |
 |
| Q |
198 |
c |
198 |
Q |
| |
|
| |
|
|
| T |
35909756 |
c |
35909756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 32494501 - 32494561
Alignment:
| Q |
31 |
tggttgatttctcgagaaatgttgcgaatccacctccagtctccttgttgtagacttgctc |
91 |
Q |
| |
|
||||||||||||| | || || || |||||||||| | |||||||||||||||||||||| |
|
|
| T |
32494501 |
tggttgatttctcaacaactgctgtgaatccacctttaatctccttgttgtagacttgctc |
32494561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University