View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_high_71 (Length: 207)
Name: NF19973_high_71
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_high_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 76 - 196
Target Start/End: Complemental strand, 24565756 - 24565636
Alignment:
| Q |
76 |
gcatgctgattaatttgcttaatactgcattctgcgttgcaattaagccaccaaacacatcatttccatccccaaaatactattggctacagccaatgcc |
175 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24565756 |
gcatgctgattaatttgcttaataatgcattctgcgttgcaattaagccaccaaacacatcatttccatccccaaaatactataggctacagccaatgcc |
24565657 |
T |
|
| Q |
176 |
tacccttcacatcacattcat |
196 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24565656 |
tacccttcacatcacattcat |
24565636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 24565776 - 24565741
Alignment:
| Q |
1 |
ccactactccaatagtccatgcatgctgattaattt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24565776 |
ccactactccaatagtccatgcatgctgattaattt |
24565741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University