View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_low_42 (Length: 283)
Name: NF19973_low_42
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 37342646 - 37342875
Alignment:
| Q |
17 |
aattatttagcatacccttctgagttaagagaaatacgattatgtctacatactaacggaacattcatgcagcggtgtccatataacaacttaaagatag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37342646 |
aattatttagcatacccttctgagttaagagaaatacgattatgtctacatactaacggaacattcatgcagcggtgtccatataacaacttaaagatag |
37342745 |
T |
 |
| Q |
117 |
gttgtggactaagattaagttggccattacaatgagataaaatgatgtggtaatcataaatatcattgttatactattcgattattattatcgggatnnn |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| | |
|
|
| T |
37342746 |
gttgtggactaacattaagttggccattacaatgagataaaatgatgtggtaatcataaatatcattgtta---ttttcgattattattatcggaacaaa |
37342842 |
T |
 |
| Q |
217 |
nnnngaacaaaacttctttgctttatgtcatat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37342843 |
aaaagaacaaaacttctttgctttatgtcatat |
37342875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University