View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19973_low_50 (Length: 250)
Name: NF19973_low_50
Description: NF19973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19973_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 9 - 120
Target Start/End: Original strand, 51010013 - 51010124
Alignment:
| Q |
9 |
gaagaatatggaaggaattggttgaaatgattctataatattccgttgcgtccaccgtcaatttaacgtgtaagtcaatgtcaatcaacaacagaaacac |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010013 |
gaagaaaatggaaggaattggttgaaatgattctataatattccgttgcgtccaccgtcaatttaacgtgtaagtcaatgtcaatcaacaacagaaacac |
51010112 |
T |
|
| Q |
109 |
gtcaagtaccac |
120 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51010113 |
gtcaagtaccac |
51010124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 51010204 - 51010248
Alignment:
| Q |
206 |
tcgacagcaacaatagaacaaatagcatgcaaggcaactcaactt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010204 |
tcgacagcaacaatagaacaaatagcatgcaaggcaactcaactt |
51010248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 38738766 - 38738717
Alignment:
| Q |
23 |
gaattggttgaaatgattctataatattccgttgcgtccaccgtcaattt |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38738766 |
gaattggttgaaatgattctataatattccgttgcgtcgaccgtcaattt |
38738717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University