View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_high_25 (Length: 288)
Name: NF19974_high_25
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 278
Target Start/End: Complemental strand, 26509174 - 26508917
Alignment:
| Q |
19 |
taattagtatggatgatttcttcaactagtaataacatcacgcctctgcagaaaaacaactgctcggctgaatgtttatcgtcaaatcattctctttctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26509174 |
taattagtatggatgatttcttcaactagtaataacatcacgcctctgcagaaaaacaactgctcggctgaatgtttatcgtcaaatcattctctttctg |
26509075 |
T |
 |
| Q |
119 |
tctgtgtgtgtatgagcatgtatttttccatccttttcttttaggctagacccacttgataagtacaagaacagctcctattgcgagtcttgaatcctaa |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26509074 |
tctgtgtgt--atgagcatgtatttttccatccttttcttttaggctagacccacttgataagtacaagaacagctcctattgcgagtcttgaatcctaa |
26508977 |
T |
 |
| Q |
219 |
acctcagatttcttatttggatttgggaagattttgccgtggtgagtgtcttggcctatg |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26508976 |
acctcagatttctgatttggatttgggaagattttgccgtggtgagtgtcttggcctatg |
26508917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University