View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_high_26 (Length: 283)
Name: NF19974_high_26
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 39085436 - 39085244
Alignment:
| Q |
17 |
atatttctatctttattttgttcttatgagagaaaataagggatgattatgaatgttgagctaacaaaaatactcaacatatgctt-ttttaagggg--- |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39085436 |
atatttctatctttattttgttcttatgaga--aaataagggatgattatgaatgttgagctaacaaaaatactcaacatatgctttttttaaggggaaa |
39085339 |
T |
|
| Q |
113 |
nnnnnnntactctac----atatgtgtcgaacaaaaattgtactactattattgttttgnnnnnnnacaatattttaattgaagcattataaaat |
203 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39085338 |
aaaaaaatactctacatatatatgtgtcgaacaaaaattgcactactattattgttttgtttttttacaatattttaattgaagcattataaaat |
39085244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 193 - 269
Target Start/End: Complemental strand, 39083639 - 39083563
Alignment:
| Q |
193 |
cattataaaatattattttcgatacatgagttgcacgggtgtagtactctggtaaagataagataactggtcctttg |
269 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39083639 |
cattataaaatattatttttgatacatgagttgcacgggtgtagtactctggtaaagataagataattggtcctttg |
39083563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 139 - 240
Target Start/End: Complemental strand, 39089379 - 39089279
Alignment:
| Q |
139 |
acaaaaattgtactactattattgttttgnnnnnnnacaatattttaattgaagcattataaaatattattttcgatacatgagttgcacgggtgtagta |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
39089379 |
acaaaaattgtactactattattgtttt-tctttttacaatttttaaattgaagcattacaaaatattatttctgatacatgagaagcacgggtgtagta |
39089281 |
T |
|
| Q |
239 |
ct |
240 |
Q |
| |
|
|| |
|
|
| T |
39089280 |
ct |
39089279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University