View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_high_43 (Length: 201)
Name: NF19974_high_43
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 9e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 41238258 - 41238425
Alignment:
| Q |
17 |
acttaccactatctccgatcaaaagaagctttatgaggtgatcgtaattcttctcacttgcaaatctcagaggagccatcaacttgcaatcaatcaatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41238258 |
acttaccactatctccgatcaaaagaagctttatgaggtgatcgtaattcttctcacttgcaaatctcagaggagccatcaacttgcaatcaatcaatga |
41238357 |
T |
|
| Q |
117 |
atttgcaacaaattatattgatacctatcagcatnnnnnnnnttattgcacgttaattcctcatatttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41238358 |
atttgcaacaaattatattgatacctatcagcataaaaaaaa-tattgcacgttaattcctcatatttt |
41238425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University