View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_low_12 (Length: 384)
Name: NF19974_low_12
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 114 - 369
Target Start/End: Original strand, 375087 - 375342
Alignment:
| Q |
114 |
ttgggttttgaagtaaatggtacttacgaacagtggagggaatatcagtagaagcatactgagatttcttgagtctgtgttgaagatgagcagcgatcca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375087 |
ttgggttttgaagtaaatggtacttacgaacagtggagggaatatcagtagaagcatactgagatttcttgagtctgtgttgaagatgagcagcgatcca |
375186 |
T |
 |
| Q |
214 |
aaccgttgagagtggtccttttcgcgccaaaaacgtttgagagtaaaacattcttcttgtttttctgtgttgattttgttgaagaattttcagagaaatg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375187 |
aaccgttgagagtggtccttttcgcgccaaaaacgtttgagagtaaaacattcttcttgtttttctgtgttgattttgttgaagaattttcagagaaatt |
375286 |
T |
 |
| Q |
314 |
aggggtttataagaaattagggttacgattggttttatttatttaaggaaagtttt |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375287 |
aggggtttataagaaattagggttacgattggttttatttatttaaggaaagtttt |
375342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 13 - 84
Target Start/End: Original strand, 374996 - 375067
Alignment:
| Q |
13 |
catcaaccctccaaagatcataaaacccatataggaatttgagaaaaattcaatctttaaaactttaagatg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
374996 |
catcaaccctccaaagatcacaaaacccatataggaatttgagaaaaatttaatcttttaaactttaagatg |
375067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University