View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_low_19 (Length: 337)
Name: NF19974_low_19
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 51 - 332
Target Start/End: Original strand, 36147855 - 36148136
Alignment:
| Q |
51 |
acacattattcaacaagaaaatcattctttcacaacactccttcattccccaaacaacacatttttcaacacttctcgtttctttcataaaggaaataac |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147855 |
acacattattcaacaagaaaatcattctttcataacactccttcattccccaaacaacacatttttcaacacttctcgtttctttcataaaggaaataac |
36147954 |
T |
 |
| Q |
151 |
cacccagttcaagaacccttatggggtaataaaatacgaaacaacactaccactgcttcactcagttatgggtcggtactaagttttgacgcaactgaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147955 |
cacccagttcaagaacccttatggggtaataaaatacgaaacaacgctaccactgcttcactgagttatgggtcggtactaagttttgacgcaactgaac |
36148054 |
T |
 |
| Q |
251 |
tcgatccggaaaactcattatctggttttctggaccgagttccgtttagtctacgacgctgggcatgttaccctatgctact |
332 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36148055 |
tcgatccagaaaactcattatctggttttctggaccgagttccgtttagtctacgacgctgggcatgttacccaatgctact |
36148136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University