View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_low_28 (Length: 277)
Name: NF19974_low_28
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 4 - 158
Target Start/End: Complemental strand, 43787689 - 43787534
Alignment:
| Q |
4 |
atgaagtataatttatttaggattttattgtcaaaagaggggagtgtatattataacatgagagg--nnnnnnnntgttattcaaacttctcttaaaaaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43787689 |
atgaagtataatttatttaggattttattgtcaaaagaggggagtgtatattataacatgagaggaaaaaaaaaatgttattcaaacttctcttaaaaaa |
43787590 |
T |
|
| Q |
102 |
gagaatgtaatttactcnnnnnnnnnntcttattccactaacttctattccctctcg |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43787589 |
gagaatgtaatttactc-aaaaaaaaatcttattccactaacttctattccctctcg |
43787534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 230 - 261
Target Start/End: Complemental strand, 43787462 - 43787431
Alignment:
| Q |
230 |
tgatttttcgaagtttatcattaaggagaaat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43787462 |
tgatttttcgaagtttatcattaaggagaaat |
43787431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University