View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_low_30 (Length: 275)
Name: NF19974_low_30
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_low_30 |
 | |
|
| [»] scaffold0147 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 12174 - 12421
Alignment:
| Q |
18 |
cttccttagttgaagagcaacaagaaatcactatggactccggggaatctctaacgaattttgggacgttacactaccgcagactattacaaggtaaagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
12174 |
cttccttagttgaagagcaacaagaaatcactatggactccggggaatctctaacgaatttcgggacgttacaccaccgcggactattacaaggtaaagg |
12273 |
T |
|
| Q |
118 |
aatcctctatgcagatcagcagctaatggaaggggaaaaaaccagatactgggttcaagaatacgcatctaatcgtactttgttccatcaagattttgcc |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274 |
aatcctctatgcagttcagcagctaatggaaggggaaaaaaccagatactgggttcaagaatacgcatctaatcgtactttgttccatcaagattttgcc |
12373 |
T |
|
| Q |
218 |
cttgcaatgatgaaactctccgatctccgagttttgacaaagcctatg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12374 |
cttgcaatgatgaaactctccgatctccgagttttgacaaagcctatg |
12421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 4425 - 4669
Alignment:
| Q |
18 |
cttccttagttgaagagcaacaagaaatcactatggactccggggaatctctaacgaattttgggacgttacactaccgcagactattacaaggtaaagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4425 |
cttccttagttgaagagcaacaagaaatcactacggactccggggaatctctatcgaatttcgggacgttatactaccgcagactattacaaggtaaagg |
4524 |
T |
|
| Q |
118 |
aatcctctatgcagatcagcagctaatggaaggggaaaaaaccagatactgggttcaagaatacgcatctaatcgtactttgttccatcaagattttgcc |
217 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4525 |
aatcctctatgaagatcagcagctgatggaaggggaaaaaaccagatattgggttc---aatacgcatctaatcgtactttgttccatcaagattttgcc |
4621 |
T |
|
| Q |
218 |
cttgcaatgatgaaactctccgatctccgagttttgacaaagcctatg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4622 |
cttgcaatgatgaaactctccgatctccgagttttgacaaagcctatg |
4669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 11998 - 12076
Alignment:
| Q |
18 |
cttccttagttgaagagcaacaagaaatcactatggactccggggaatctctaacgaattttgggacgttacactaccg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11998 |
cttccttagttgaagagcaacaagaaatcactatggactccggggaatctctaacgaattttgggacgttacactaccg |
12076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University