View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19974_low_38 (Length: 246)

Name: NF19974_low_38
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19974_low_38
NF19974_low_38
[»] chr8 (1 HSPs)
chr8 (15-227)||(1422903-1423115)


Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 1423115 - 1422903
Alignment:
15 cacagataaacttaaacctaattagaaattttatacaaaaatgaagaatcgatgaacatgatagaaactggagaaatatgatagatagatagaataaaaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1423115 cacagataaacttaaacctaattagaaattttatacaaaaatgaagaatcgatgaacatgatagaaactggagaaatatgatagatagatagaataaaaa 1423016  T
115 agaaagtataacagtggagaaaagcaaactcgagagaattatgggatgattttgtgatgttgaattggtcttcctatttctcacccaaaaaattaggtta 214  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1423015 agaaagtataacagtggagaaaaggaaactcgagagaattatgggatgattttgtgatgttgaattggtcttcctatttctcacccaaaaaattaggtta 1422916  T
215 tattgttccttct 227  Q
    |||| ||||||||    
1422915 tattattccttct 1422903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University