View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19974_low_41 (Length: 220)
Name: NF19974_low_41
Description: NF19974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19974_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 104 - 214
Target Start/End: Original strand, 46751509 - 46751619
Alignment:
| Q |
104 |
atatctttgaccatctcgtaaaacataattttgtctaatagatcctattctcgtaaaacaatttaatttcgtgtaggagacttaaagcaaaagcaagaag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46751509 |
atatctttgaccatctcgtaaaacataattttgtctaatagatcctattctcgtaaaacaatttaatttcgtgtaggagacataaagcaaaagcaagaag |
46751608 |
T |
 |
| Q |
204 |
atattcttgga |
214 |
Q |
| |
|
||||||||||| |
|
|
| T |
46751609 |
atattcttgga |
46751619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University