View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19975_high_27 (Length: 307)
Name: NF19975_high_27
Description: NF19975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19975_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 28007890 - 28007679
Alignment:
| Q |
1 |
aatatcaccatgctgtcatcgtgattttgccatattttatggttaattttaacatttgttaagagttgcataacttggtcaacaattgtttgaccaacct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| || || |||||||| | |||||||||||||| |
|
|
| T |
28007890 |
aatatcacgatgctgtcatcgtgattttgccatattc-atggtcaattttaacatttgttaagagttgtatgacgtggtcaaccactgtttgaccaacct |
28007792 |
T |
 |
| Q |
101 |
agatttcaattttgattttacggatgtggaaccaaacataagctaaaatgcttcatttgagcaatatagcaagtcactagtaagataacaaaatagcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28007791 |
agatttcaattttgattttacggatgtggaaccaaacataggctaaaatgcttcatttgagcaatatagcaagtcactagtaagataataaaatagcaaa |
28007692 |
T |
 |
| Q |
201 |
tatttttaaccag |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28007691 |
tatttttaaccag |
28007679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 28007637 - 28007597
Alignment:
| Q |
263 |
caatactcttctcgtgaaattaaccatgacaaaaaactcaa |
303 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28007637 |
caatactcttcttgtgaaattaaccatgacaaaaaactcaa |
28007597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University