View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19975_high_32 (Length: 248)
Name: NF19975_high_32
Description: NF19975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19975_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 7628492 - 7628285
Alignment:
| Q |
19 |
aactatccataaacgatccaaatctaacttatcataatctactcacatgtatccctcgaggacaactgttagagtaaaggtaaagactcaaaaatcttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7628492 |
aactatccataaacgatccaaatctaacttatcataatctactcacatgtatccctcgaggacaactgttagagtaaaggtaaagactcaaaaatcttaa |
7628393 |
T |
|
| Q |
119 |
tccctcacttctctatcccaaaaatttcacatattcaacgcatttttatttgagagtaagtggcggaggccctttagggcatgggtgagccatgacccac |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7628392 |
tccctcacttctctatctcaaaaatttcacatattcaacgcatttttatttgagagtaagtggcggaggccctttagggcatgggtgcgccatgacccac |
7628293 |
T |
|
| Q |
219 |
cccccaat |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
7628292 |
cccccaat |
7628285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University