View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19975_low_24 (Length: 370)
Name: NF19975_low_24
Description: NF19975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19975_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 11 - 351
Target Start/End: Complemental strand, 41518013 - 41517670
Alignment:
| Q |
11 |
acatcatcatcactaacagtttggaaaaaatcccttgtaattaattgtaaaggattcacagtcatagattcatgtggaaaccttgtgtatcgtgttgata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41518013 |
acatcatcatcactaacagtttggaaaaaatcccttgtaattaattgtaaaggattcacagtcatagattcatgtggaaaccttgtgtatcgtgttgata |
41517914 |
T |
 |
| Q |
111 |
attactccttgcacccccatgaagttgttcttatggatgcttcaggaaactctcttctctctatgcgccgccaaagggtatcatttcctcttcatctttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41517913 |
attactccttgcacccccatgaagttgttcttatggatgcttcaggaaactctcttctctctatgcgccgccaaagggtatcatttcctcttcatctttc |
41517814 |
T |
 |
| Q |
211 |
ttatgc-ttttactgctt--agctttgcttgatagtataatgagttagttattagatttagatactgcaccgtcaattataaactcagtatccgactcaa |
307 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41517813 |
ttatgctttttactgatttcagctttgcttgatagtataatgagttagttattagatttagatactacaccgtcaattataaactcagtatccgactcaa |
41517714 |
T |
 |
| Q |
308 |
agacctgctcgtactaaattgtggttgattttattcatgcataa |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41517713 |
agacctgctcgtactaaattgtggttgattttattcatgcataa |
41517670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University