View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19975_low_25 (Length: 328)
Name: NF19975_low_25
Description: NF19975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19975_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 126 - 318
Target Start/End: Complemental strand, 29805510 - 29805318
Alignment:
| Q |
126 |
ctaatcgtgtgtgggtttatgtaccctaaatttatctactcaattattgttcttaacgatttcaaattacatgtagtatcttgaagttttgtaggcattt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29805510 |
ctaatcgtgtgtgggtttatgtaccctaaatttatctactcaattattattcttaacgatttcaaattacatgtagtatcttgaagttttgtaggcattt |
29805411 |
T |
 |
| Q |
226 |
agagaaaatggattgttggaggctttcaatcaaaggagaaaagtctgattgtaaatggtgtaacccaacttagacaatcttgaatgatgatgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29805410 |
agagaaaatggattgttggaggctttcaatcaaaggagaaaagtctgattgtaaatggtgtaacccaacttagacaatcttgaatgatgatgt |
29805318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 29805620 - 29805557
Alignment:
| Q |
18 |
atatttgcattgattaaaatttgaaattag--tttaaatttaagtagttctaattgttgtcatc |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29805620 |
atatttgcattgattaaaatttgaaattagtttttaaatttaagtagttctaattgttgtcatc |
29805557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University