View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19976_high_20 (Length: 203)
Name: NF19976_high_20
Description: NF19976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19976_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 5421002 - 5420828
Alignment:
| Q |
13 |
gaacctgtgatgcagcctaatccagtgacatatggaacaaacatttttcatgaaaaggaagaaacaaattcagatgtatcagaggagttatatgatgaaa |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5421002 |
gaacctctgatgcagcctaatccagtgacatatggaacaaacatttttcatgaaaaggaagaaacaaattcagatgtatcagaggagttatatgatgaaa |
5420903 |
T |
|
| Q |
113 |
agttatgcataatttgttttgatgaacaacgcaactgtttctttgttccttgcggtcattgtgccacttgctatg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5420902 |
agttatgcataatttgttttgatgaacaacgcaactgtttctttgttccttgcggtcattgtgccacttgctatg |
5420828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University