View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19976_low_16 (Length: 260)
Name: NF19976_low_16
Description: NF19976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19976_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 43089262 - 43089496
Alignment:
| Q |
16 |
gtagcatcaaaagatgatgataatcttctgctgtgaataggaattgaagctgtaaactcgttcctgttactctcattgtgattgtacctttcctgcaaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43089262 |
gtagcatcaaaagatgatgataatcttctgctgtgaataggaattgaagctgtgtactcgttcctgttactctcattgtgattatacctttcctgcaaaa |
43089361 |
T |
 |
| Q |
116 |
taaaaatcataagaaatgtaaatattcaagtgatactaggaattagaatatgagatctgtttatgtattttaccgtggatcttctagcttgtgtttgaaa |
215 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089362 |
taacaatcataagaaatgtaaatattcaagtgatactaggaattaaaatatgagatctgtttatgtattttaccgtggatcttctagcttgtgtttgaaa |
43089461 |
T |
 |
| Q |
216 |
tctgttatttgtttcattctttgtgtttatgatga |
250 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43089462 |
tctgttatttgtttcattctttgtgcttatgatga |
43089496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University