View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19976_low_18 (Length: 226)

Name: NF19976_low_18
Description: NF19976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19976_low_18
NF19976_low_18
[»] chr4 (1 HSPs)
chr4 (19-107)||(53935388-53935476)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 53935388 - 53935476
Alignment:
19 agtatgggacctgcctctgcttgcaactgcaatgcaatcaattcttctatcacaaggttcaaaagttgaatctcaaacatacgtacaga 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53935388 agtatgggacctgcctctgcttgcaactgcaatgcaatcaattcttctatcacaaggttcaaaagttgaatctcaaacatacgtacaga 53935476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University