View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19976_low_18 (Length: 226)
Name: NF19976_low_18
Description: NF19976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19976_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 53935388 - 53935476
Alignment:
| Q |
19 |
agtatgggacctgcctctgcttgcaactgcaatgcaatcaattcttctatcacaaggttcaaaagttgaatctcaaacatacgtacaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53935388 |
agtatgggacctgcctctgcttgcaactgcaatgcaatcaattcttctatcacaaggttcaaaagttgaatctcaaacatacgtacaga |
53935476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University