View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19977_low_1 (Length: 374)
Name: NF19977_low_1
Description: NF19977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19977_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 16 - 358
Target Start/End: Complemental strand, 29137754 - 29137413
Alignment:
| Q |
16 |
atattattagataaaacgccaaagagactttcagctgtccatttggcataaatattgtccttgtcggaataatgtcacgtaaaagttcattaaataaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137754 |
atattattagataaaacgccaaagagactttcagctttccatttggcataaatattgtccttgtcggaataatgtcacgtaaaagttcattaaataaaca |
29137655 |
T |
 |
| Q |
116 |
tcaatattttgcattatcactgtttcctttgtcggtttcacttttgtatcatactttttaattttctttcacgtatatatctaaatatctaaagcataca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137654 |
tcaatattttgcattatcactgtttcctttgtcggtttcacttttgtatcatactttttaattttctttcacgtatatatctaaatatctaaagcataca |
29137555 |
T |
 |
| Q |
216 |
tcatcatatgttatgctggaacactagttgcaacactatgttggatgtattcatttttcattctttctcatgaatatgtttttctgaatgttgatttgtc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137554 |
tcatcatatgttatgctggaacactagttgcaacactatgttggatgtattca-ttttcattctttctcatgaatatgtttttctgaatgttgatttgtc |
29137456 |
T |
 |
| Q |
316 |
ttgttttattcatcaaattatactgtctacgaaatctcatatt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137455 |
ttgttttattcatcaaattatactgtctacgaaatctcatatt |
29137413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University