View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19977_low_2 (Length: 255)
Name: NF19977_low_2
Description: NF19977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19977_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 163 - 240
Target Start/End: Original strand, 2331870 - 2331947
Alignment:
| Q |
163 |
gttttaataatttattttgtaactatagttatgaaccggatgaacactagctattcgaagaactgcacataagtattt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2331870 |
gttttaataatttattttgtaactaaagttatgaaccggatgaacactagctattcgaagaactgcacataagtattt |
2331947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 54 - 130
Target Start/End: Original strand, 2329651 - 2329729
Alignment:
| Q |
54 |
acaaacaacaaaatccaacttcaaagcaccatgacaatagcag--aaaaaatttaacatcaaacacacaagtttttaac |
130 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
2329651 |
acaaacaacaaaatccaactccaaagcaccatggcaatagcagacaaaaaaattaacatcaaacacacgagtttttaac |
2329729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University