View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19978_low_5 (Length: 227)
Name: NF19978_low_5
Description: NF19978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19978_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 32460001 - 32460223
Alignment:
| Q |
6 |
aataataacagtctaatcttaattcattggtcgaaatgtgttgtttgtaaggtattttgaccacatctaatcgagagtggaa-attagtgatggtgagga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32460001 |
aataataacagtctaatcttaattcattggtcgagatgtgttgtctgtaaggtattttgaccacatctaatcgagagtggaagattagtgatggtgagga |
32460100 |
T |
|
| Q |
105 |
tctggtccacttggactaagtcgattggtcgaatattgtgttcccaacaattgcttccttctcatgatttccttcaccacttgcttgacactttctacaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32460101 |
tctggtccacttggactaagtcgattggtcgaatattgtgttcccaacaattgcttccttctcatgatttccttcaccacttgcttgacactttctacaa |
32460200 |
T |
|
| Q |
205 |
atgcagggcttccattgctactt |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32460201 |
atgcagggcttccattgctactt |
32460223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University