View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19979_low_5 (Length: 262)
Name: NF19979_low_5
Description: NF19979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19979_low_5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 262
Target Start/End: Complemental strand, 6207830 - 6207563
Alignment:
| Q |
2 |
taagttttacccattttcttcgtatatt-gagtagaatacctttatcatttgacgacaacaactaacatccatac-tctaatccacgctacctcc-atcc |
98 |
Q |
| |
|
|||||||||||| ||||| ||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
6207830 |
taagttttaccctttttcctcgtatatttgagcagaatacctttatcatttgacgacaacaactaaaatccatacctctaatccacgctacctcccatcc |
6207731 |
T |
|
| Q |
99 |
ccatagtcaaactcctcatatttggatgtaaaaagaaaactaaaccgcacccgttagtggtagtggtagttttgaagatgagaatgatgttgataacgat |
198 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6207730 |
cgagagtcaaactcctcatatttggatgtaaaaagaaaactaaaccgcacccgttagtggtactggtagttttgaagatgagaatgatgttgataacgat |
6207631 |
T |
|
| Q |
199 |
atgtttttagac----tatgttaatttatttcatattattatgctcaagattgtttgttgtttatttt |
262 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
6207630 |
atgtttttagactatatatgttaatttatttcatattattatgctcaagattgtttgctgtttgtttt |
6207563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University