View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19979_low_8 (Length: 204)

Name: NF19979_low_8
Description: NF19979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19979_low_8
NF19979_low_8
[»] chr6 (1 HSPs)
chr6 (34-181)||(6207836-6207985)


Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 34 - 181
Target Start/End: Original strand, 6207836 - 6207985
Alignment:
34 aattggctagtgtttgatggagaataggttagtgttcaaagtgaaagattcatagattattacatgaataagaccatgtt------tttgagacactatg 127  Q
    ||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||   |||||||||      ||||||| ||||||    
6207836 aattgactagtgtttgatggagaataggctagtgttcaaagtgaaagattcataggttattacatgaa---gaccatgtttttgtttttgagagactatg 6207932  T
128 tttcttccataaatgtggtcttctctatgtaattgtcttgttttttcactttgc 181  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||    
6207933 tttcttccataaatgtggtcttctctatgtaattgtcttg-tttttcactttgc 6207985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University