View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1997_low_1 (Length: 300)
Name: NF1997_low_1
Description: NF1997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1997_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 124 - 283
Target Start/End: Complemental strand, 1133939 - 1133777
Alignment:
| Q |
124 |
tgttgtcttttgaactcgtgggaacgcactactttatgaggatcttcacttaannnnnnnnnnnnnnnngt---cttttactttgggacacaataattga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
1133939 |
tgttgtcttttgaactcgtgggaacgcactactttatgaggatcttcacttaatttttttactatttttttgttcttttactttgggacacaataattga |
1133840 |
T |
 |
| Q |
221 |
catattacttaatttgagaatctaagcttcacctctagatgttcatgtttcaatatttggttt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
1133839 |
catattacttaatttgagaatctaagcttcgcctatagatgttcatgtttcaatatttggttt |
1133777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 1134070 - 1133997
Alignment:
| Q |
1 |
cttgtgaaggccacgtcatcagggactttgtttagtgatgaagaaggcatgatgatgtgcactatactcttttg |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1134070 |
cttgtgaaggccacgtcatcagggactttgtttagtgatgaagaaggcatgatgatgtgcactatactcttttg |
1133997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University