View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1997_low_6 (Length: 271)
Name: NF1997_low_6
Description: NF1997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1997_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 30 - 261
Target Start/End: Complemental strand, 44710232 - 44710001
Alignment:
| Q |
30 |
gatccttggtttactactgctacaatctagatcagcctctgttccaatgtcttgtaagctgtatctggttcttaacatggcttgcctacttcacatttta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44710232 |
gatccttggtttactactgctacaatctagatcagcctctgttccaatgtcttgtaggctgtatctggttcttaacatggcttgcctacttcacatttta |
44710133 |
T |
|
| Q |
130 |
gacaacccgaaaaacgagtaagcgctgctgcaaaactccccggctttgccttgatgtctgacttgggaaaatttgcagccttagttccagactgtttaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44710132 |
gacaacccgaaaaacgagtaagcgctgctgcaaaactccctggctttgccttgatgtctgacttgggaaaatttgcagccttagttccagactgtttaaa |
44710033 |
T |
|
| Q |
230 |
gaaggctccattcatcatcaagtcattctctg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44710032 |
gaaggctccattcatcatcaagtcattctctg |
44710001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University