View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19981_high_8 (Length: 253)
Name: NF19981_high_8
Description: NF19981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19981_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 1340962 - 1341195
Alignment:
| Q |
20 |
aacaagacaagacaatcagaaacaaagttgagagagtgagaagctcttgctttaggaaaatctaaatctccatgagggtatgacaatttatgacaacaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1340962 |
aacaagacaagacaatcagaaacaaagttgagagagtgagaagctcttgctttaggaaaatctaaatctccatgagggtatgacaatttatgacaacaaa |
1341061 |
T |
 |
| Q |
120 |
cagaatccatctgatatattttcttatagagtttcatccatgaaaactgatgaacatgatggttggaagtattacaagacttgactagtgaatccacaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1341062 |
cagaatccatctgatatattttcttatagagtttcatccatgaaaactgatgaacatgatggttggaagtattacaagacttgactagtgaatccacaca |
1341161 |
T |
 |
| Q |
220 |
tgttgaactcaagtctctcttgcataaggatttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1341162 |
tgttgaactcaagtctctcttgcataaggatttc |
1341195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University