View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19982_high_6 (Length: 248)
Name: NF19982_high_6
Description: NF19982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19982_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 248
Target Start/End: Complemental strand, 36771701 - 36771463
Alignment:
| Q |
11 |
atgaagaaacaagtgatgcaaacctgctcttcaaaaatttgcacaatccaacggtgaaccnnnnnnnggggaattgttttcgctcttcttttcccttttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36771701 |
atgaagaaacaagtgatgcaaacctgctcttcaaaaatttgcacagtccaacggtgaacgaaaaaaacgggaattgttttcgctcttcttttcccttttt |
36771602 |
T |
 |
| Q |
111 |
gatggttgttctcctcaccaaaatactctctccttgcaactttagtatgacccc-ttccgacttatataagtgagacataatagactaatatttgggtct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36771601 |
gatggttgttctcctcaccaaaatactctctccttgcaactttagtatgacccccttccgacttatataagtgagacataatagactaatatttgggtct |
36771502 |
T |
 |
| Q |
210 |
tcaaaaagcaagcctaatacccaacacaactctatatcc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36771501 |
tcaaaaagcaagcctaatacccaacacaactctatatcc |
36771463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University