View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19982_low_10 (Length: 222)

Name: NF19982_low_10
Description: NF19982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19982_low_10
NF19982_low_10
[»] chr1 (1 HSPs)
chr1 (15-197)||(10133451-10133632)


Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 10133632 - 10133451
Alignment:
15 aatatcttcacacttatcaagtacacgtattaaaaacttacaatcttttgcagcagtagcatcctatgtcctatattgctttctccggtaataatttgag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10133632 aatatcttcacacttatcaagtacacgtattaaaaacttacaatcttttgcagcagtagcatcctatgtcctatattgctttctccggtaataatttgag 10133533  T
115 gacgtgtaatgttttggtctcaaaacacatgttctagaacttgttactccttatccatttaccttatcttacgtcactttgta 197  Q
    ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10133532 gacgtat-atgttttggtctcaaaacacatgttctagaacttgttactccttatccatttaccttatcttacgtcactttgta 10133451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University