View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19983_high_12 (Length: 239)
Name: NF19983_high_12
Description: NF19983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19983_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 35823766 - 35823977
Alignment:
| Q |
17 |
cgttatgccaagatataagttgagattgcttgtgcatacattctttgtgatggctactaaaggcatgaacaatgtcttgagtaatagctttgattttgac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35823766 |
cgttatgccaagatataagttgagattgcttgtgcatacattctttgtgatggctactaaaggcatgaacaatgtcttgagtaatagctttgattttgac |
35823865 |
T |
 |
| Q |
117 |
cactaaagacatgtgaccgcctcttcatgatctaaccaagaatatgctgatttcacccatcctccaaaaccttagctttcataatagtattctaaatagg |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35823866 |
cactaaagacgtgtgaccgcctcttcatgatttaaccaagaatatgctgatttcacccatcctccaaaaccttagctttcataatagtatttcaaatagg |
35823965 |
T |
 |
| Q |
217 |
gaaaactttctt |
228 |
Q |
| |
|
| |||||||||| |
|
|
| T |
35823966 |
ggaaactttctt |
35823977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University