View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19983_high_14 (Length: 234)

Name: NF19983_high_14
Description: NF19983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19983_high_14
NF19983_high_14
[»] chr1 (2 HSPs)
chr1 (19-113)||(36610062-36610156)
chr1 (175-214)||(36610218-36610257)


Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 36610062 - 36610156
Alignment:
19 atgagagtagatagaccagacattctatacgctaatcgacaagatggacggttgagattgtatcttgttccagatcaatgcaacacaaatgatgt 113  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||    
36610062 atgagagtagatagaccagacattctatatgctaatcgacaagatggacggttgagattgtatcttgttccagatgaatgcaacgcaaatgatgt 36610156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 36610218 - 36610257
Alignment:
175 attacaatagtagaatcggaatcagaagaggaaataatgg 214  Q
    ||||||||||||||||||||||||||||||||||||||||    
36610218 attacaatagtagaatcggaatcagaagaggaaataatgg 36610257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University