View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19983_low_11 (Length: 274)
Name: NF19983_low_11
Description: NF19983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19983_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 43454527 - 43454254
Alignment:
| Q |
1 |
tgatcatgtaattttgatattgtttgcttccctacacataagaaatgttttactttattatgtcatcttttacaacaaaccattgtcaacatttattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
43454527 |
tgatcatgtaattttgatattgtttgcttccctacacataagaaatgttttactttattatgtcatcttttaaaacaaaccattgtcaacacttattttt |
43454428 |
T |
 |
| Q |
101 |
gtagtaatttggggagagatttagatattcaattttaaacttatgtctataggaagaatatttgttaaatgatgttagcatcttaaatagatagatcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43454427 |
gtagtaatttggggagagatttagatattcaattttaaacttatgtctataggaagaatatttgttaaatgatgttagcatcttaaatagatagatcttt |
43454328 |
T |
 |
| Q |
201 |
gtgtttatatagttctcggtcgtgattttgtttgttgcccgtttagacaatatacggtcaatgataaatgaagt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43454327 |
gtgtttatatagttctcggtcgtgattttgtttgttgcccgtttagacaatatgcggtcaatgataaatgaagt |
43454254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University