View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19983_low_16 (Length: 214)
Name: NF19983_low_16
Description: NF19983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19983_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 6 - 193
Target Start/End: Original strand, 28120349 - 28120533
Alignment:
| Q |
6 |
gagaagcaaagggaaggtttggggaaagaggaaaacaaaaaaggtagggtttccaatttgcgaagccatggaattagtaactaaagaagagggaacagtt |
105 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28120349 |
gagaaacaaaaggaaggtttggggaaagaggaaaacaaaaaaggtagggtttccaatttgcgaagccatggaa---gtaactaaagaagagggaacagtt |
28120445 |
T |
 |
| Q |
106 |
tctatacattaattttagtgaaatccataaatctttgaattgattaacaaatgatatgtggtcggttgttacgtactcaaatgggtag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28120446 |
tctatacattaattttagtgaaatccataaatctttgaattgattaacaaatgatatgtggtcggttgttacgtactcaaatgggtag |
28120533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University