View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19983_low_7 (Length: 385)
Name: NF19983_low_7
Description: NF19983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19983_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 5 - 264
Target Start/End: Original strand, 36609897 - 36610156
Alignment:
| Q |
5 |
gagtagcaaagggatgaatattgtttgaggaatatgagggcggtggagggaggtgtaaatagtaataacacatttcctccaccactttcttcgttaaaca |
104 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36609897 |
gagtatcaaggggatgaatattgtttgaggaatacgagggcggtggagggaggtgtaaatagtaataacacatttcctccaccactttcttcgttagaca |
36609996 |
T |
|
| Q |
105 |
ataactgtcaaccaagttatattttattaccggtgaggaaggatggaagattacaactcaacaaaatgagagtagatagaccagacattctatacgctaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36609997 |
ataactgtcaaccaagttatattttattaccggtgaggaaggatggaagattacaactcaacaaaatgagagtagatagaccagacattctatatgctaa |
36610096 |
T |
|
| Q |
205 |
tcgacaagatggacggttgagattgtatcttgttccagatcaatgcaacacaaatgatgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
36610097 |
tcgacaagatggacggttgagattgtatcttgttccagatgaatgcaacgcaaatgatgt |
36610156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 326 - 365
Target Start/End: Original strand, 36610218 - 36610257
Alignment:
| Q |
326 |
attacaatagtagaatcggaatcagaagaggaaataatgg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36610218 |
attacaatagtagaatcggaatcagaagaggaaataatgg |
36610257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University